The X in the accompanying diagram is:

(a) amniotic egg 

(b) bipedal locomotion 

(c) diapsid skull 

(d) four chambered heart

A pure tall pea plant (Pisum sativum) with axillary pods is crossed with dwarf pea plant with terminal pods. Out of 48 F₂ generation plants, how many will have phenotype like parents? 

(a) 18 

(b) 27 

(c) 30 

(d) 20

Following sequence of RNA, when translated will form a protein molecule of _____ amino acids.

5′ GCUCGCAUGCCAGAUGUCUUCGUCCUUUAGUUUAUUAGA 3′ 

(a) 3 

(b) 7 

(c) 6 

(d) 9

Which of the following is the main criteria for distinguishing ectotherms from endotherms? 

(a) The source of heat used to maintain body temperature. 

(b) Body temperature being constant or variable. 

(c) Amount of heat used to maintain body temperature. 

(d) Amount of calories produced in body

Five leaf discs of a hydrophyte were submerged in 0.2% sodium bicarbonate solution (containing a small quantity of soap) and another five discs were submerged in plain water. Which of the following will happen? 

(a) Discs in bicarbonate solution rise while those in plain water remain submerged. 

(b) Discs in bicarbonate solution and in plain water, both remain submerged. 

(c) Discs in plain water rise earlier than those in bicarbonate solution. 

(d) Discs in bicarbonate solution and in plain water, both rise at the same time.

Two ecological pyramids (I and II) are shown. Mark the correct statement that describes them.

(a) I is a biomass pyramid while II is a number pyramid. 

(b) I is likely to represent rain forest while II represents desert ecosystem. 

(c) I is biomass pyramid of a grassland and II is number pyramid of oceanic ecosystem. 

(d) I is an energy pyramid of rain forest and Ii is biomass pyramid of host and parasite. 

In a population of a species with 500 gene loci, half the loci are fixed.In the remaining, there are two alleles at each locus. How many alleles are therein the gene pool? 

(a) 500 

(b) 750 

(c) 250 

(d) 550

The carbon atom (C) is one of the most important atoms in biological molecules. Several roperties of this “atom make it suitable for life on earth. 

Which of the following statements are true? 

I. Carbon-carbon bond energy is higher than the energy of visible spectrum of light. 

ii. Carbon-nitrogen bonds can be broken by UV light spontaneously. 

iii. Each hydrogen bond in water is stronger than the carbon-carbon covalent bond. 

iv. Carbon-hydrogen bond can be broken by infra red light spontaneously. 

(a) i & ii 

(b) i & iii 

(c) ii & iv 

(d) i, ii & iv

The gas transfer system found in Aves is represented in following figures: (Bold arrows represent blood flow while thin arrows represent air flow through respiratory stem.) 

The correct representation is in the figure:

Which of the following animals has blood as circulating medium? 

(a) Cockroach 

(b) Mussel 

(c) Leech 

(d) Planaria