Nseb

Which of the following assist in the locomotion of earthworm? 

i. Muscles in the body wall 

ii. Coelomic fluid 

iii. Septa 

iv. Setae 

(a) i, ii, iii and iv 

(b) Only i, ii and iv 

(c) Only ii, iii and iv 

(d) Only i and iv

Which of the following statements about plasmids is true? 

(a) Plasmids are genetically indispensable for host cells in the absence of a selection pressure. 

(b) Some plasmids have the ability to transfer themselves physically from one cell to another. 

(c) Plasmids are naked DNA molecules capable of survival outside a living cell’. 

(d) Plasmids do not depend on host enzymatic machinery for their replication.

Following sequence of RNA, when translated will form a protein molecule of _____ amino acids.

5′ GCUCGCAUGCCAGAUGUCUUCGUCCUUUAGUUUAUUAGA 3′ 

(a) 3 

(b) 7 

(c) 6 

(d) 9

Which process of cell ingestion is shown in diagram below?

(a) Exocytosis 

(b) Pinocytosis 

(c) Phagocytosis 

(d) Macrophage engulfing an infectious agent

Which of the diagrams given below will best represent stabilising selection In a population with continuous variations? X axis represents phenotype with quantitative variation while Y axis represents frequency of individuals,

Study the pedigree chart of a family showing the inheritance of a disorder and trace the trait.

(a) Dominant X-linked 

(b) Recessive X-linked 

(c) Autosomal dominant 

(d) Autosomal recessive

Consider four different striated muscles M1, M2, M3 and M4 of varying lengths L1, L2, L3 and L4. All these muscles have fibers running parallel to their longitudinal axis. Muscles M1, M2 and M4 have similar area of cross section while M3 has double than others. if L2= L3, 2*L3 = L4 and L1 =1/4 L2, the maximum force produced by a muscle will be greater in : 

(a) M1 

(b) M2 

(c) M3 

(d) M4

Which of the following is the main criteria for distinguishing ectotherms from endotherms? 

(a) The source of heat used to maintain body temperature. 

(b) Body temperature being constant or variable. 

(c) Amount of heat used to maintain body temperature. 

(d) Amount of calories produced in body

Five leaf discs of a hydrophyte were submerged in 0.2% sodium bicarbonate solution (containing a small quantity of soap) and another five discs were submerged in plain water. Which of the following will happen? 

(a) Discs in bicarbonate solution rise while those in plain water remain submerged. 

(b) Discs in bicarbonate solution and in plain water, both remain submerged. 

(c) Discs in plain water rise earlier than those in bicarbonate solution. 

(d) Discs in bicarbonate solution and in plain water, both rise at the same time.

Three genes A, Band C are involved in determination of skin colour. If a couple with fair skin colour, produced a child with dark skin colour, then the genotype of the parents most probably can be: 

(a) Aabbcc x aaBbcc 

(b) AAbbcc x aabbcc 

(c) Aabbcc x aaBBcc 

(d) AaBbcc x aaBbCc